ssODN (single-stranded oligodeoxynucleotide):
- Length: 100-200nt total
- Homology arms: 30-60nt each side
- Best for: Small insertions (<50bp), point mutations
- Delivery: Electroporation with RNP

dsDNA (double-stranded DNA):
- Length: 500bp - 5kb total
- Homology arms: 200-800bp each side
- Best for: Larger insertions (tags, reporters)
- Delivery: Plasmid or PCR product

Plasmid donor:
- Homology arms: 500-2000bp
- Best for: Large insertions (>1kb), conditional alleles
- Delivery: Transfection

from Bio.Seq import Seq

def design_ssodn(target_seq, cut_site, insert_seq='', arm_length=50):
    '''Design single-stranded oligo donor for HDR

    Args:
        target_seq: Genomic sequence around cut site
        cut_site: Position of Cas9 cut (3bp upstream of PAM)
        insert_seq: Sequence to insert (empty for deletion/mutation)
        arm_length: Length of each homology arm (30-60nt optimal)

    ssODN considerations:
    - Total length should be 100-200nt (synthesis limit)
    - Asymmetric arms can improve HDR (PAM-distal shorter)
    - Strand choice: complementary to non-target strand often better
    '''
    # Extract homology arms
    left_arm = target_seq[cut_site - arm_length:cut_site]
    right_arm = target_seq[cut_site:cut_site + arm_length]

    # Assemble ssODN
    ssodn = left_arm + insert_seq + right_arm

    # Also provide reverse complement (may work better)
    ssodn_rc = str(Seq(ssodn).reverse_complement())

    return {
        'sense': ssodn,
        'antisense': ssodn_rc,
        'length': len(ssodn),
        'left_arm_length': len(left_arm),
        'right_arm_length': len(right_arm),
        'insert_length': len(insert_seq)
    }


def design_ssodn_mutation(target_seq, mutation_pos, new_base, arm_length=50):
    '''Design ssODN for a point mutation

    For point mutations, center the mutation in the ssODN.
    Also introduce silent PAM mutation to prevent re-cutting.
    '''
    # Build mutant sequence
    mutant = list(target_seq)
    mutant[mutation_pos] = new_base
    mutant_seq = ''.join(mutant)

    # Extract arms around mutation
    left_start = mutation_pos - arm_length
    right_end = mutation_pos + arm_length + 1

    ssodn = mutant_seq[left_start:right_end]

    return {
        'sequence': ssodn,
        'length': len(ssodn),
        'mutation_position_in_ssodn': arm_length,
        'original_base': target_seq[mutation_pos],
        'new_base': new_base
    }

def design_asymmetric_ssodn(target_seq, cut_site, insert_seq, pam_position):
    '''Design ssODN with asymmetric homology arms

    Asymmetric arms can improve HDR efficiency:
    - PAM-proximal arm: 30-40nt (shorter)
    - PAM-distal arm: 60-90nt (longer)

    The longer arm is on the side that gets resected first.
    '''
    # Determine which side is PAM-proximal
    if pam_position > cut_site:  # PAM is to the right
        left_arm_length = 70   # PAM-distal (longer)
        right_arm_length = 35  # PAM-proximal (shorter)
    else:  # PAM is to the left
        left_arm_length = 35
        right_arm_length = 70

    left_arm = target_seq[cut_site - left_arm_length:cut_site]
    right_arm = target_seq[cut_site:cut_site + right_arm_length]

    ssodn = left_arm + insert_seq + right_arm

    return {
        'sequence': ssodn,
        'length': len(ssodn),
        'left_arm_length': left_arm_length,
        'right_arm_length': right_arm_length,
        'asymmetry': 'PAM-distal longer'
    }

def design_dsdna_donor(target_seq, cut_site, insert_seq, arm_length=500):
    '''Design double-stranded DNA donor for larger insertions

    Args:
        target_seq: Extended genomic sequence (need ~2kb around cut)
        cut_site: Position of Cas9 cut
        insert_seq: Sequence to insert (tag, reporter, etc.)
        arm_length: Homology arm length (200-800bp recommended)

    For PCR amplification, returns primer sequences for arms.
    '''
    left_arm = target_seq[cut_site - arm_length:cut_site]
    right_arm = target_seq[cut_site:cut_site + arm_length]

    donor = left_arm + insert_seq + right_arm

    return {
        'sequence': donor,
        'length': len(donor),
        'left_arm': left_arm,
        'right_arm': right_arm,
        'insert': insert_seq
    }


def design_pcr_primers_for_donor(left_arm, right_arm, insert_seq, tm_target=60):
    '''Design PCR primers to amplify HDR donor

    Creates primers for Gibson assembly or overlap PCR.
    '''
    # Forward primer: 5' end of left arm
    fwd_primer = left_arm[:20]

    # Reverse primer: 3' end of right arm (reverse complement)
    rev_primer = str(Seq(right_arm[-20:]).reverse_complement())

    # Overlap primers for Gibson assembly
    # Left arm reverse with insert overhang
    left_overlap = str(Seq(left_arm[-20:]).reverse_complement()) + insert_seq[:15]

    # Right arm forward with insert overhang
    right_overlap = insert_seq[-15:] + right_arm[:20]

    return {
        'left_arm_fwd': fwd_primer,
        'left_arm_rev': left_overlap,
        'right_arm_fwd': right_overlap,
        'right_arm_rev': rev_primer
    }

# Common tag sequences for knock-ins
TAGS = {
    'FLAG': 'GATTACAAGGATGACGATGACAAG',
    '3xFLAG': 'GATTACAAGGATGACGATGACAAGGATTACAAGGATGACGATGACAAGGATTACAAGGATGACGATGACAAG',
    'HA': 'TACCCATACGATGTTCCAGATTACGCT',
    'V5': 'GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG',
    'MYC': 'GAACAAAAACTCATCTCAGAAGAGGATCTG',
    '6xHIS': 'CATCACCATCACCATCAC',
    'GFP_LINKER': 'GGCGGAGGCGGAAGC',  # Flexible linker before GFP
}

def design_tag_insertion(target_seq, cut_site, tag_name, position='C-term'):
    '''Design HDR donor for protein tagging

    Args:
        position: 'N-term' or 'C-term' relative to target gene

    For C-terminal tagging, insert before stop codon.
    For N-terminal tagging, insert after start codon.
    '''
    tag_seq = TAGS.get(tag_name, tag_name)  # Use custom if not in dict

    # Add linker if needed
    if position == 'C-term':
        insert = TAGS['GFP_LINKER'] + tag_seq  # Linker before tag
    else:
        insert = tag_seq + TAGS['GFP_LINKER']  # Tag then linker

    return design_ssodn(target_seq, cut_site, insert)

def add_silent_pam_mutation(donor_seq, pam_position, codon_table='standard'):
    '''Add silent mutation to disrupt PAM in donor

    After HDR, the PAM should be disrupted to prevent Cas9
    from cutting the edited allele.

    Strategy:
    - If PAM (NGG) is in coding region, make synonymous change
    - Change GG to GA, GC, or GT (no longer recognized)
    - Ensure the mutation is synonymous (silent)
    '''
    donor = list(donor_seq)

    # NGG PAM - mutate second G to A (most common silent option)
    if pam_position + 2 < len(donor):
        if donor[pam_position + 1:pam_position + 3] == ['G', 'G']:
            # Try GG -> GA (often silent in 3rd codon position)
            donor[pam_position + 2] = 'A'

    return ''.join(donor)